Review



cep 1  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Thermo Fisher cep 1
    Cep 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 90 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cep 1/product/Thermo Fisher
    Average 94 stars, based on 90 article reviews
    cep 1 - by Bioz Stars, 2026-03
    94/100 stars

    Images



    Similar Products

    94
    Thermo Fisher cep 1
    Cep 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cep 1/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    cep 1 - by Bioz Stars, 2026-03
    94/100 stars
      Buy from Supplier

    96
    MedChemExpress cep cells
    Piezo1 expression was elevated in human degenerated cartilaginous endplate <t>(CEP)</t> tissues <t>and</t> <t>LPS‐treated</t> CEP cells. (a–d) western blot analysis showing the protein expression levels of Piezo1, cleaved caspase‐3 and RUNX2 in human CEP tissues (three control and three degenerated samples). (e–h) The protein expression of Piezo1, cleaved caspase‐3 and RUNX2 in CEP cells was upregulated by LPS. (i) Piezo1 mRNA levels in LPS‐treated CEP cells were measured by qRT–PCR. (j) Immunofluorescence staining of Piezo1 in CEP cells after LPS treatment. Scale bar, 50 μm. (k, l) The effects of LPS on CEP cell apoptosis were analysed by flow cytometry using Annexin V‐FITC/PI staining. ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).
    Cep Cells, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cep cells/product/MedChemExpress
    Average 96 stars, based on 1 article reviews
    cep cells - by Bioz Stars, 2026-03
    96/100 stars
      Buy from Supplier

    90
    Macrogen c40h1.3( cep-104 ) f sgrna 1 tctt gttcctagatgacgacattg
    Piezo1 expression was elevated in human degenerated cartilaginous endplate <t>(CEP)</t> tissues <t>and</t> <t>LPS‐treated</t> CEP cells. (a–d) western blot analysis showing the protein expression levels of Piezo1, cleaved caspase‐3 and RUNX2 in human CEP tissues (three control and three degenerated samples). (e–h) The protein expression of Piezo1, cleaved caspase‐3 and RUNX2 in CEP cells was upregulated by LPS. (i) Piezo1 mRNA levels in LPS‐treated CEP cells were measured by qRT–PCR. (j) Immunofluorescence staining of Piezo1 in CEP cells after LPS treatment. Scale bar, 50 μm. (k, l) The effects of LPS on CEP cell apoptosis were analysed by flow cytometry using Annexin V‐FITC/PI staining. ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).
    C40h1.3( Cep 104 ) F Sgrna 1 Tctt Gttcctagatgacgacattg, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c40h1.3( cep-104 ) f sgrna 1 tctt gttcctagatgacgacattg/product/Macrogen
    Average 90 stars, based on 1 article reviews
    c40h1.3( cep-104 ) f sgrna 1 tctt gttcctagatgacgacattg - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Macrogen c40h1.3( cep-104 ) r sgrna 1 caatgtcgtcatctaggaac
    Piezo1 expression was elevated in human degenerated cartilaginous endplate <t>(CEP)</t> tissues <t>and</t> <t>LPS‐treated</t> CEP cells. (a–d) western blot analysis showing the protein expression levels of Piezo1, cleaved caspase‐3 and RUNX2 in human CEP tissues (three control and three degenerated samples). (e–h) The protein expression of Piezo1, cleaved caspase‐3 and RUNX2 in CEP cells was upregulated by LPS. (i) Piezo1 mRNA levels in LPS‐treated CEP cells were measured by qRT–PCR. (j) Immunofluorescence staining of Piezo1 in CEP cells after LPS treatment. Scale bar, 50 μm. (k, l) The effects of LPS on CEP cell apoptosis were analysed by flow cytometry using Annexin V‐FITC/PI staining. ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).
    C40h1.3( Cep 104 ) R Sgrna 1 Caatgtcgtcatctaggaac, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c40h1.3( cep-104 ) r sgrna 1 caatgtcgtcatctaggaac/product/Macrogen
    Average 90 stars, based on 1 article reviews
    c40h1.3( cep-104 ) r sgrna 1 caatgtcgtcatctaggaac - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    EUROIMMUN anti-cep (anti-cep-1), elisa (igg) ea 151b-9601 g
    Piezo1 expression was elevated in human degenerated cartilaginous endplate <t>(CEP)</t> tissues <t>and</t> <t>LPS‐treated</t> CEP cells. (a–d) western blot analysis showing the protein expression levels of Piezo1, cleaved caspase‐3 and RUNX2 in human CEP tissues (three control and three degenerated samples). (e–h) The protein expression of Piezo1, cleaved caspase‐3 and RUNX2 in CEP cells was upregulated by LPS. (i) Piezo1 mRNA levels in LPS‐treated CEP cells were measured by qRT–PCR. (j) Immunofluorescence staining of Piezo1 in CEP cells after LPS treatment. Scale bar, 50 μm. (k, l) The effects of LPS on CEP cell apoptosis were analysed by flow cytometry using Annexin V‐FITC/PI staining. ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).
    Anti Cep (Anti Cep 1), Elisa (Igg) Ea 151b 9601 G, supplied by EUROIMMUN, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti-cep (anti-cep-1), elisa (igg) ea 151b-9601 g/product/EUROIMMUN
    Average 90 stars, based on 1 article reviews
    anti-cep (anti-cep-1), elisa (igg) ea 151b-9601 g - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    94
    Thermo Fisher cep 1 locus
    Piezo1 expression was elevated in human degenerated cartilaginous endplate <t>(CEP)</t> tissues <t>and</t> <t>LPS‐treated</t> CEP cells. (a–d) western blot analysis showing the protein expression levels of Piezo1, cleaved caspase‐3 and RUNX2 in human CEP tissues (three control and three degenerated samples). (e–h) The protein expression of Piezo1, cleaved caspase‐3 and RUNX2 in CEP cells was upregulated by LPS. (i) Piezo1 mRNA levels in LPS‐treated CEP cells were measured by qRT–PCR. (j) Immunofluorescence staining of Piezo1 in CEP cells after LPS treatment. Scale bar, 50 μm. (k, l) The effects of LPS on CEP cell apoptosis were analysed by flow cytometry using Annexin V‐FITC/PI staining. ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).
    Cep 1 Locus, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cep 1 locus/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    cep 1 locus - by Bioz Stars, 2026-03
    94/100 stars
      Buy from Supplier

    90
    Medicago weblogo legume-specific consensus cep domain 1 motif
    Piezo1 expression was elevated in human degenerated cartilaginous endplate <t>(CEP)</t> tissues <t>and</t> <t>LPS‐treated</t> CEP cells. (a–d) western blot analysis showing the protein expression levels of Piezo1, cleaved caspase‐3 and RUNX2 in human CEP tissues (three control and three degenerated samples). (e–h) The protein expression of Piezo1, cleaved caspase‐3 and RUNX2 in CEP cells was upregulated by LPS. (i) Piezo1 mRNA levels in LPS‐treated CEP cells were measured by qRT–PCR. (j) Immunofluorescence staining of Piezo1 in CEP cells after LPS treatment. Scale bar, 50 μm. (k, l) The effects of LPS on CEP cell apoptosis were analysed by flow cytometry using Annexin V‐FITC/PI staining. ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).
    Weblogo Legume Specific Consensus Cep Domain 1 Motif, supplied by Medicago, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/weblogo legume-specific consensus cep domain 1 motif/product/Medicago
    Average 90 stars, based on 1 article reviews
    weblogo legume-specific consensus cep domain 1 motif - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    Image Search Results


    Piezo1 expression was elevated in human degenerated cartilaginous endplate (CEP) tissues and LPS‐treated CEP cells. (a–d) western blot analysis showing the protein expression levels of Piezo1, cleaved caspase‐3 and RUNX2 in human CEP tissues (three control and three degenerated samples). (e–h) The protein expression of Piezo1, cleaved caspase‐3 and RUNX2 in CEP cells was upregulated by LPS. (i) Piezo1 mRNA levels in LPS‐treated CEP cells were measured by qRT–PCR. (j) Immunofluorescence staining of Piezo1 in CEP cells after LPS treatment. Scale bar, 50 μm. (k, l) The effects of LPS on CEP cell apoptosis were analysed by flow cytometry using Annexin V‐FITC/PI staining. ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).

    Journal: Aging Cell

    Article Title: Piezo1 exacerbates inflammation‐induced cartilaginous endplate degeneration by activating mitochondrial fission via the Ca 2+ / CaMKII /Drp1 axis

    doi: 10.1111/acel.14440

    Figure Lengend Snippet: Piezo1 expression was elevated in human degenerated cartilaginous endplate (CEP) tissues and LPS‐treated CEP cells. (a–d) western blot analysis showing the protein expression levels of Piezo1, cleaved caspase‐3 and RUNX2 in human CEP tissues (three control and three degenerated samples). (e–h) The protein expression of Piezo1, cleaved caspase‐3 and RUNX2 in CEP cells was upregulated by LPS. (i) Piezo1 mRNA levels in LPS‐treated CEP cells were measured by qRT–PCR. (j) Immunofluorescence staining of Piezo1 in CEP cells after LPS treatment. Scale bar, 50 μm. (k, l) The effects of LPS on CEP cell apoptosis were analysed by flow cytometry using Annexin V‐FITC/PI staining. ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).

    Article Snippet: To mimic the inflammatory microenvironment of CEP degeneration, 10 μg/mL LPS (Biosharp, China) was used to treat CEP cells for 12 h. Then, CEP cells were treated with 5 μM Yoda1 (MedChemExpress, USA) or 10 μM GsMTx4 (MedChemExpress, USA) for 12 h to investigate the function of Piezo1 in inflammation‐induced CEP cells.

    Techniques: Expressing, Western Blot, Control, Quantitative RT-PCR, Immunofluorescence, Staining, Flow Cytometry

    Piezo1 promoted cartilaginous endplate (CEP) cell senescence and apoptosis by triggering mitochondrial fragmentation and dysfunction. (a, f) The influences of Yoda1 and GsMTX4 on intracellular Ca 2+ levels in LPS‐treated CEP cells were using the specific Ca 2+ ‐sensitive fluorescent indicator Fluo‐4 AM. Scale bar, 100 μm. (b) The expression of apoptosis‐related proteins (cleaved caspase‐3, Bax, Bcl‐2) was measured by western blotting. (c) The expression of senescence‐related proteins (p53, p21 and p16) was measured by western blotting. (d, g) The effects of Yoda1 and GsMTX4 on LPS‐induced apoptosis of CEP cells were analysed by flow cytometry with Annexin V‐FITC/PI. (e, h) Flow cytometry with β‐galactosidase staining was used to evaluate the level of CEP cell senescence. (i) The mitochondrial morphology in CEP cells was detected by MitoTracker Red staining. Scale bar, 25 μm. (j, m) The MMP in CEP cells was assessed by flow cytometry using JC‐1 staining. (k, l, n and o) The production of mitochondrial and cellular reactive oxygen species (ROS) in CEP cells was measured by MitoSOX Red and DCFH‐DA staining, respectively. Scale bars, 50 μm (k) and 100 μm (l). (p) Relative ATP contents in LPS‐induced CEP cells after treated with Yoda1 or GsMTx4. ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).

    Journal: Aging Cell

    Article Title: Piezo1 exacerbates inflammation‐induced cartilaginous endplate degeneration by activating mitochondrial fission via the Ca 2+ / CaMKII /Drp1 axis

    doi: 10.1111/acel.14440

    Figure Lengend Snippet: Piezo1 promoted cartilaginous endplate (CEP) cell senescence and apoptosis by triggering mitochondrial fragmentation and dysfunction. (a, f) The influences of Yoda1 and GsMTX4 on intracellular Ca 2+ levels in LPS‐treated CEP cells were using the specific Ca 2+ ‐sensitive fluorescent indicator Fluo‐4 AM. Scale bar, 100 μm. (b) The expression of apoptosis‐related proteins (cleaved caspase‐3, Bax, Bcl‐2) was measured by western blotting. (c) The expression of senescence‐related proteins (p53, p21 and p16) was measured by western blotting. (d, g) The effects of Yoda1 and GsMTX4 on LPS‐induced apoptosis of CEP cells were analysed by flow cytometry with Annexin V‐FITC/PI. (e, h) Flow cytometry with β‐galactosidase staining was used to evaluate the level of CEP cell senescence. (i) The mitochondrial morphology in CEP cells was detected by MitoTracker Red staining. Scale bar, 25 μm. (j, m) The MMP in CEP cells was assessed by flow cytometry using JC‐1 staining. (k, l, n and o) The production of mitochondrial and cellular reactive oxygen species (ROS) in CEP cells was measured by MitoSOX Red and DCFH‐DA staining, respectively. Scale bars, 50 μm (k) and 100 μm (l). (p) Relative ATP contents in LPS‐induced CEP cells after treated with Yoda1 or GsMTx4. ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).

    Article Snippet: To mimic the inflammatory microenvironment of CEP degeneration, 10 μg/mL LPS (Biosharp, China) was used to treat CEP cells for 12 h. Then, CEP cells were treated with 5 μM Yoda1 (MedChemExpress, USA) or 10 μM GsMTx4 (MedChemExpress, USA) for 12 h to investigate the function of Piezo1 in inflammation‐induced CEP cells.

    Techniques: Expressing, Western Blot, Flow Cytometry, Staining

    Piezo1 modulated mitochondrial morphology and function by influencing CaMKII activity. (a, b) western blot analysis showed that the level of CaMKII phosphorylation was regulated by Yoda1 and BAPTA‐AM. (c, d) TUNEL staining showed that KN‐93 partially reversed Yoda1‐induced cartilaginous endplate (CEP) cell apoptosis. Scale bar, 100 μm. (e, f) Flow cytometry with Annexin V‐FITC/PI verified the protective effects of KN‐93 on CEP cell apoptosis. (g) Double immunofluorescence staining indicated the colocalization of p‐Drp1 and MitoTracker Red. Scale bar, 25 μm. (h, k) Flow cytometry using JC‐1 to examine the MMP in CEP cells. (i, j, l, m) MitoSOX Red and DCFH‐DA staining were used to detect the production of mitochondrial and cellular reactive oxygen species (ROS) in CEP cells. Scale bars, 50 μm (I) and 100 μm (j). ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).

    Journal: Aging Cell

    Article Title: Piezo1 exacerbates inflammation‐induced cartilaginous endplate degeneration by activating mitochondrial fission via the Ca 2+ / CaMKII /Drp1 axis

    doi: 10.1111/acel.14440

    Figure Lengend Snippet: Piezo1 modulated mitochondrial morphology and function by influencing CaMKII activity. (a, b) western blot analysis showed that the level of CaMKII phosphorylation was regulated by Yoda1 and BAPTA‐AM. (c, d) TUNEL staining showed that KN‐93 partially reversed Yoda1‐induced cartilaginous endplate (CEP) cell apoptosis. Scale bar, 100 μm. (e, f) Flow cytometry with Annexin V‐FITC/PI verified the protective effects of KN‐93 on CEP cell apoptosis. (g) Double immunofluorescence staining indicated the colocalization of p‐Drp1 and MitoTracker Red. Scale bar, 25 μm. (h, k) Flow cytometry using JC‐1 to examine the MMP in CEP cells. (i, j, l, m) MitoSOX Red and DCFH‐DA staining were used to detect the production of mitochondrial and cellular reactive oxygen species (ROS) in CEP cells. Scale bars, 50 μm (I) and 100 μm (j). ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).

    Article Snippet: To mimic the inflammatory microenvironment of CEP degeneration, 10 μg/mL LPS (Biosharp, China) was used to treat CEP cells for 12 h. Then, CEP cells were treated with 5 μM Yoda1 (MedChemExpress, USA) or 10 μM GsMTx4 (MedChemExpress, USA) for 12 h to investigate the function of Piezo1 in inflammation‐induced CEP cells.

    Techniques: Activity Assay, Western Blot, TUNEL Assay, Staining, Flow Cytometry, Double Immunofluorescence Staining

    Piezo1 induced mitochondrial fission and dysfunction via the Ca 2+ /CaMKII/Drp1 axis in LPS‐treated cartilaginous endplate (CEP) cells. (a–e) The effects of KN‐93 on the phosphorylation and mitochondrial translocation of Drp1 were assessed using western blotting. (f, g, l, m) TUNEL staining and flow cytometry with Annexin V‐FITC/PI demonstrated that Mdivi‐1 partially rescued Yoda1‐induced CEP cell apoptosis. Scale bar, 100 μm. (h) The colocalization between p‐Drp1 and MitoTracker Red was verified by double immunofluorescence staining. Scale bar, 25 μm. (i, n) The MMP in CEP cells was evaluated by flow cytometry using JC‐1. (j, k, o, p) The production of mitochondrial and cellular reactive oxygen species (ROS) in CEP cells was measured by MitoSOX Red and DCFH‐DA staining, respectively. Scale bars, 50 μm (j) and 100 μm (k). ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).

    Journal: Aging Cell

    Article Title: Piezo1 exacerbates inflammation‐induced cartilaginous endplate degeneration by activating mitochondrial fission via the Ca 2+ / CaMKII /Drp1 axis

    doi: 10.1111/acel.14440

    Figure Lengend Snippet: Piezo1 induced mitochondrial fission and dysfunction via the Ca 2+ /CaMKII/Drp1 axis in LPS‐treated cartilaginous endplate (CEP) cells. (a–e) The effects of KN‐93 on the phosphorylation and mitochondrial translocation of Drp1 were assessed using western blotting. (f, g, l, m) TUNEL staining and flow cytometry with Annexin V‐FITC/PI demonstrated that Mdivi‐1 partially rescued Yoda1‐induced CEP cell apoptosis. Scale bar, 100 μm. (h) The colocalization between p‐Drp1 and MitoTracker Red was verified by double immunofluorescence staining. Scale bar, 25 μm. (i, n) The MMP in CEP cells was evaluated by flow cytometry using JC‐1. (j, k, o, p) The production of mitochondrial and cellular reactive oxygen species (ROS) in CEP cells was measured by MitoSOX Red and DCFH‐DA staining, respectively. Scale bars, 50 μm (j) and 100 μm (k). ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).

    Article Snippet: To mimic the inflammatory microenvironment of CEP degeneration, 10 μg/mL LPS (Biosharp, China) was used to treat CEP cells for 12 h. Then, CEP cells were treated with 5 μM Yoda1 (MedChemExpress, USA) or 10 μM GsMTx4 (MedChemExpress, USA) for 12 h to investigate the function of Piezo1 in inflammation‐induced CEP cells.

    Techniques: Translocation Assay, Western Blot, TUNEL Assay, Staining, Flow Cytometry, Double Immunofluorescence Staining

    Knockdown of Piezo1 inhibited Drp1‐dependent mitochondrial fission. (a) The level of CaMKII phosphorylation and Drp1 phosphorylation after si‐Piezo1 treatment was measured by western blot analysis. (b) The subcellular localization of Drp1 was detected by western blotting. (c, d) The expression levels of apoptosis‐related and senescence‐related proteins were measured by western blot analysis. (e) The colocalization of Drp1 and mitochondria was shown by immunofluorescence staining and confocal microscopy. Scale bar, 10 μm. (f) The mitochondrial morphology was demonstrated by MitoTracker Red staining. Scale bar, 10 μm. (g, h) The intracellular Ca 2+ levels were analysed by using the specific Ca 2+ ‐sensitive fluorescent indicator Fluo‐4 AM. Scale bar, 40 μm. (i–l) The accumulation of mitochondrial and cellular reactive oxygen species (ROS) in cartilaginous endplate (CEP) cells was measured by MitoSOX Red and DCFH‐DA staining, respectively. Scale bars, 40 μm (i) and 40 μm (k). (m) Relative adenosine triphosphate (ATP) productions in CEP cells treated by si‐Piezo1. (n) The MMP was evaluated by flow cytometry using JC‐1. (o) Flow cytometry with Annexin V‐FITC/PI showed that si‐Piezo1 partially rescued LPS‐induced CEP cell apoptosis. (p) Cellular senescence was analysed by using flow cytometry with β‐galactosidase staining. ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).

    Journal: Aging Cell

    Article Title: Piezo1 exacerbates inflammation‐induced cartilaginous endplate degeneration by activating mitochondrial fission via the Ca 2+ / CaMKII /Drp1 axis

    doi: 10.1111/acel.14440

    Figure Lengend Snippet: Knockdown of Piezo1 inhibited Drp1‐dependent mitochondrial fission. (a) The level of CaMKII phosphorylation and Drp1 phosphorylation after si‐Piezo1 treatment was measured by western blot analysis. (b) The subcellular localization of Drp1 was detected by western blotting. (c, d) The expression levels of apoptosis‐related and senescence‐related proteins were measured by western blot analysis. (e) The colocalization of Drp1 and mitochondria was shown by immunofluorescence staining and confocal microscopy. Scale bar, 10 μm. (f) The mitochondrial morphology was demonstrated by MitoTracker Red staining. Scale bar, 10 μm. (g, h) The intracellular Ca 2+ levels were analysed by using the specific Ca 2+ ‐sensitive fluorescent indicator Fluo‐4 AM. Scale bar, 40 μm. (i–l) The accumulation of mitochondrial and cellular reactive oxygen species (ROS) in cartilaginous endplate (CEP) cells was measured by MitoSOX Red and DCFH‐DA staining, respectively. Scale bars, 40 μm (i) and 40 μm (k). (m) Relative adenosine triphosphate (ATP) productions in CEP cells treated by si‐Piezo1. (n) The MMP was evaluated by flow cytometry using JC‐1. (o) Flow cytometry with Annexin V‐FITC/PI showed that si‐Piezo1 partially rescued LPS‐induced CEP cell apoptosis. (p) Cellular senescence was analysed by using flow cytometry with β‐galactosidase staining. ( n = 3 biological replicates, * p < 0.05; ** p < 0.01; *** p < 0.001).

    Article Snippet: To mimic the inflammatory microenvironment of CEP degeneration, 10 μg/mL LPS (Biosharp, China) was used to treat CEP cells for 12 h. Then, CEP cells were treated with 5 μM Yoda1 (MedChemExpress, USA) or 10 μM GsMTx4 (MedChemExpress, USA) for 12 h to investigate the function of Piezo1 in inflammation‐induced CEP cells.

    Techniques: Knockdown, Western Blot, Expressing, Immunofluorescence, Staining, Confocal Microscopy, Flow Cytometry

    Inhibition of Piezo1 by GsMTx4 or AAV‐shPiezo1 attenuated inflammation‐induced cartilaginous endplate (CEP) degeneration in vivo. (a, b) The coccygeal vertebrae of rats were examined by magnetic resonance imaging (MRI). (c) H&E staining, Safranin O‐Fast Green staining and Alcian Blue staining of rat IVD samples. (d) Evaluation of IVDD by histological score. (e, f) Immunohistochemistry of cleaved caspase‐3. (g) Relative adenosine triphosphate (ATP) contents in IVD tissues. ( n = 6 biological replicates, *** p < 0.001).

    Journal: Aging Cell

    Article Title: Piezo1 exacerbates inflammation‐induced cartilaginous endplate degeneration by activating mitochondrial fission via the Ca 2+ / CaMKII /Drp1 axis

    doi: 10.1111/acel.14440

    Figure Lengend Snippet: Inhibition of Piezo1 by GsMTx4 or AAV‐shPiezo1 attenuated inflammation‐induced cartilaginous endplate (CEP) degeneration in vivo. (a, b) The coccygeal vertebrae of rats were examined by magnetic resonance imaging (MRI). (c) H&E staining, Safranin O‐Fast Green staining and Alcian Blue staining of rat IVD samples. (d) Evaluation of IVDD by histological score. (e, f) Immunohistochemistry of cleaved caspase‐3. (g) Relative adenosine triphosphate (ATP) contents in IVD tissues. ( n = 6 biological replicates, *** p < 0.001).

    Article Snippet: To mimic the inflammatory microenvironment of CEP degeneration, 10 μg/mL LPS (Biosharp, China) was used to treat CEP cells for 12 h. Then, CEP cells were treated with 5 μM Yoda1 (MedChemExpress, USA) or 10 μM GsMTx4 (MedChemExpress, USA) for 12 h to investigate the function of Piezo1 in inflammation‐induced CEP cells.

    Techniques: Inhibition, In Vivo, Magnetic Resonance Imaging, Staining, Immunohistochemistry